UVAS Library

Your cart is empty.

Your search returned 3 results. Subscribe to this search

Not what you expected? Check for suggestions
Unhighlight Highlight
|
1.
No cover image available
Isolation Of Local Strain Of Toxoplasma Gondii Through In-Vivo Cultivation In Mice

by Rahim Gul | Dr. Muhammad Imran Rashid | Dr. Aneela | Dr. Nisar Ahmad.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Toxoplasma gondii is an obligate apicomplexan, intracellular, parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat faeces or through the consumption of meat containing Toxoplasma gondii cysts. Thus, food animals can be the source of transmission of Toxoplasmosis in human population especially among people who consume undercooked meat in the forms of barbecues, beef steaks, kebabs, burgers and shawarmas. Oocysts of T. gondii from cat faeces were identified by using direct microscopy and flotation technique. The positive oocysts were confirmed by micrometry having diameter of 9-13 ìm. The oocysts were then sporulated in aerated condition. After sporulation oocyst were inoculated in Swiss albino mice for in-vivo culturing. After 56-70 days brain tissue was collected from infected mice and subjected to DNA extraction and PCR amplification. Similarly DNA was also extracted from sporulated oocyst for copro-PCR. Out of 200 faecal samples only three were found positive for Toxoplasma gondii through direct microscopic examination and flotation technique. From positive faecal sample and brain tissue DNA was extracted by QIAGEN mini stool kit and QIAGEN DNA mini kit. After DNA extraction the samples were examined through PCR by using specific Toxoplasma gondii B1 gene primer having 529 bp size. Two hundred faecal samples were examined for T. gondii using direct microscopy, flotation technique, bioassay and polymerase chain reaction. Out of 200 samples 3 (1.5%) were found infected through direct microscopy and flotation technique. Toxoplasmosis was more prevalent in adult cats (1.65%) as compared to young ones. Prevalence was also found high in females (2.08%) as compared to males. Similarly healthy cats have higher prevalence rate (1.30%) as compared to diseased ones. A further confirmation was done through polymerase chain reaction and brain tissue cyst Bioassay give 1 positive amplification while Copro-PCR gives 2 positive amplifications. Therefore it can be concluded that the copro-PCR is can be used for the confirmation of Toxoplasma oocysts from cat faeces and tissue cysts from bioassay in mice. Therefore, we propose that the copro-PCR can be used as the new gold standard for determining potential cat infectivity and tissue cysts from bioassayed mice or contaminated meat samples of livestock. Availability: Items available for loan: UVAS Library [Call number: 1778,T] (1).

Place hold Add to cart
2.
No cover image available
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice

by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr. SUMMARY 132 Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited SUMMARY 133 elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).

Place hold Add to cart
3.
No cover image available
Larvicidal And Adulticidal Effect Of Natural Herbs Against Mosquito Population

by Anam Shahwar (2015-VA-1347) | Dr. Nisar Ahmad | Dr. Muhammad Imran Rashid | Dr. Uzma Farid Durrani .

Material type: book Book; Literary form: not fiction Publisher: 2017Dissertation note: Mosquitoes serve as vectors for a wide assortment of human and veterinary pathogens and cause pervasion of numerous infection. Many processes fall for the control of mosquito but the cross resistance didn’t let them successful. Plants are viewed as the natural industry of such chemicals which have promising medicinal and pesticidal properties. Ocimum basilicum regularly known as Basal and Calotropis procera which is famous as apple of Sodom has shown the insecticidal activities against mosquito. Ocimum basilicum and Calotropis procera has adulticidal and larvicidal activity against laboratory reared mosquito population. For the study plants of Calotropis procera and Ocimum basilicum has collected from Lahore city. Leaves stem and flower of Ocimum basilicum and leaves of Calotrops procera had ground after drying for their soxhelet extraction. Their methanol and aequeous extract was used against laboratory reared mosquito to check their efficacy. Serial dilutions of each plant was given to third and fourth instar larvae and three day old adult. Third and fourth instar larvae has shown complete mortality within one hour in 700ppm and 650 ppm of methanol extract of both plant whereas in water extract the concenteration were 450ppm and 500ppm. Mortality of larvae and adult mosquito has been recorded after every ten minutes for one hour and then after 24 hours. The lethal dose concentration from dose-probit model is 700ppm of and 650ppm (methanol extraction) and 450ppm and 500ppm (water extraction) of Ocimum basilicum and Calotropis procera. according The current study has checked the efficacy of indigenous plant extracts against mosquito for eco-friendly approach to control mosquito. Availability: Items available for loan: UVAS Library [Call number: 2949-T] (1).

Place hold Add to cart

Implemented and Maintained by UVAS Library.
For any Suggestions/Query Contact to library or Email:rehana.kousar@uvas.edu.pk Phone:+91 99239068
Website/OPAC best viewed in Mozilla Browser in 1366X768 Resolution.